Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518297
Length 566 bp
Fasta Format > rwhcs10f15
aactgcaaatgggtatcaaatgtttcacaatctctgatgtcacggcggca gaaggatttcaagtactctaaaacatttagctagaagggactaaaccatt gatcataaccaccaacaaaaatattttccttgtttacagaacaccatcgc acttcgcacttctgtttcaaacagattactttgaggtcgtcttgtccttg gtcttctgtattttcaacaccttcttcacgatcttctgctcctcaaccaa gaaagcgcggatgatcctttccctcactgcagttccagagagcactccac catagggacggttcacagtcctgcggttcctagacaaccttgatcttttg tattcagtaggcctgaggtggggaatcccctggatcttcttcccggtcac agggcacttggggccgctcgccctcttcttggtgtactggtacactagct taccacctggggtcttgacgacccgcgtctggttggacttggtggcatag ctgtgcctcttccggtaggtcaggcgctgcaccatgtttccgtcgtctcc gccgccggcagtaggg
Download
page-top