Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518294
Length 679 bp
Fasta Format > rwhcs10f07
aacctacaccgaaaatcttcttgacatgaataaagacccaacccagacta ctgctcagagagcaaatccaacccataagagcaccatagatttgaactgg ttgtgcaggcagataacccaaacaccctagtaaccacccttgagatcatt gaccacatcgtacggaatgggagtgacggtctcgattgtggtaccctcaa ccatgaacccaggtttagggccgagcggctgcctcttggtgctgatgacc tcaccacgtgccttggcttcctccttgagctggtcattcttcactttcct caggcggaactcctccgcacacctggatggctgcacatgctcaacacgga catggatccttttcctgataatgcggtttccaacctgcttgttgatctcg acgccgatggcgcgcttggtgacgttccacacgcgtccggtgcggccgtg gtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacat cgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatg taacccttcttccggaacgggcgcgcgaacaggtcgcgcgtccgcgaccg cagaccgtggcccgccggcatcctgctcctcctgctttgcttcgcggggc ggcggcgggagaagggtggcggcacnang
Download
page-top