Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518291
Length 748 bp
Fasta Format > rwhcs10f04
agacggacccataactaactgcaaataacacactggtccctgtcttttac aaagaggaccccaacaaccagataagaaaagcaatcgggtccttgacatc ttctgcacggccgtaacttcgccgtcgccggggacattgccacttgggac aactaagcttccatggcaccacgccatagactccgtgcagaagatgagct gcctccctttaggcatcttggccgggaggaagaagtagaaaggccgccct tcggccagcatgtacgatgacgtgatggagccggccggccgccgaacgcc gtagctggcgccaaggccactcccaaacagccaccggataagagcactga cccgatctggttctccatctcttctactcttcgtcttcaccaccacggcg acgccacgagctagagaagtagcggagagcctccagaacaggggaccaga cgagcttattggtggatgagccagcagcacgcccctcggcagcgactggc cgccagccagccttgcctgagacgcagccaccgtgagccaccagccgctg ctcgtacgcggcggcggcgctctccacatcggcatacagccatacgccac atgggcactactcgacctcaacctatacctagattctatatacataggac aacgccatgcacctctcccgtctccgctccggccggcgaggccgtcggag aagataagggatcgggccgggagcggtggaactctctcgactctcaac
Download
page-top