Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518288
Length 146 bp
Fasta Format > rwhcs10e24
cactgggggaangcctggccggacgtngcggccctcnnggtgcttgagaa cccaaaggattcaatgacggggaggtaggccttgatgttgtagagcgngg taccttgcctctgcatctcctccaanacgtgccctctcttcngatt
Download
page-top