Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518286
Length 857 bp
Fasta Format > rwhcs10e21
cagccatgcatggtctagctctagctctagctctagctctagctctagct agctagcacatcatccaatccaagcaaggttaagctaggttcaggttggt tggttcaacaacgccaacaccacaaacggtaacatccatgggaacgttcc cagcggcacccgacacaacggaccgacttacgggcaccctggataacagc taaagttccaggtgccatctagatagtacatagatagataggtactagta ggttttatttatacagacgcacggttcaacctccactgacagaaagcggc atcgatcaagttcaagagcagcatcagatcagcagaagaacatggagctc ctcactttctcgtgcagccgaggcagctccggcaccggggcgctgcccgc agacgtgtggccccctccctggctcgacgacgtgtccgacatgtcctcaa acttcatgaaggtgcccacctgcgccgccgccagatgcgcgtacgctatc ggagcagctactgatatcgccgtcgtgctcctctggtacacataggagag cgagtgcacaaactcctggagctcatccccactgaagccgatctcatcat gcagaacatggtaatgcgttggcctcgacgtgccaatcatcccagcatgc gcgcacatgtanaagtcaaagttcttgggatggcacacttgtttatccac cacagtgccaggaggaacattttctggcgagtttgtctggaaaaacctgg tatgatggtttttctgagcaacaatgaccgtgaacttgggctcccacttg tcgtcaaggcacttgcatgcctcaatgatctgctcaagctcaatgtttat cacctga
Download
page-top