Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518279
Length 864 bp
Fasta Format > rwhcs10e13
gcagcatcctaacaggtattcaaaggttctgaggcaccaagttgcggcaa ccagcttaggaacacaacataccaggagtcccaacaggccatcacaggcc actaccacatactactagtactagataaccaagcgcataaccaaaagttg gaacgcgcaagtgcagcaggctggcgggctggctcagcagaagaacatgc tgctacggaccttctcatggaggcgaggcagctcctgcactggggcactg ccggcagaggtgtggccaccaccctggctcgacgacgtctctgacatctc atcaaactttatgaactgcgccacctgagctgccgcaagatgtgcatagc agattggagaaacaactgatatggctgttgtgctcctttggtacacatac gagagcgagtgcacaagatcctgcaggtcatccgcggcaaagtgtatctc atcatgtaggatatggtagtgcgttggccttgtagtcccaatcattccag catgggcgcacatgtagaagtcataattccttggatggcagacggcatta tctacaacagtgcctggagggacattctcaggagatccaggaatgaagaa cttggtgtggtgatttttctgagcaacaatcaacgtgaacttggggttcc aattttcatccaagaacttgcaggcctcaattatttgatccaattcaatg ttcagcacctgattaaaactggctctcactaacaccatccctgaagatga tgatctgatctggtttcctttttccagaactggtgtanaagtcaatgaga cactcccgaacaaggccatcatcatcaanttccttgnggcttgaacaatg aatctatcatttct
Download
page-top