Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518277
Length 856 bp
Fasta Format > rwhcs10e10
gtctcaggcacaggagtttagccgaagcaggaatagaaatacagtaatta aacgacagacaggatcattgctcgcccgggataagagtctgcagcaacaa aagcaatgaccatgaacaaaaaccttctgctagatagatgcctatttctt cttgatggcagccttggtaaccttggcgccggtggggtccttcttctcca cgcccttgatgacaccaacagcaaccgtttgtctcatgtcacgcacagcg aagcggccaagaggagggtaggtggcgaaggtctccacaaccatgggctt ggtgggaatcatcttcacgataccagcgtcaccgttcttcaggaacttgg gcagcgcctccagctccttaccagatcgcctgtcgatcttagtcaccagc tcagcaaacttcacagcaatgtgggaggtgtggcagtccagcactggggc gtagccgttgccgatctgaccagggtggttcatgatgatgacctgggagg tgaagttggctgcctccttggcagggtcatccttggagttggatgcaaca aacccacgcttcagatccttaacagcaacgttcttcacgttgaagccaac attgtcaccaggaagcgcctccaggagggactcgtggtgcatctcaacgg acttgacctcagttgtcagaccagtgggaccaaaggtaacaaccatacca ggcttgatgacaccagtctcaacacggccaacaggcacagttccaatgcc accaatcttgtaaacgtcctgaaggggaagacgcangggcttgtctgagg gcctcttgggctcnttgatctggtcaagagcctcaanaaagggtanggcc cttgta
Download
page-top