Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518276
Length 418 bp
Fasta Format > rwhcs10e09
gcagagagaanatattcctacttcatagacaacacngggggcgactccng gacattgcgngagtanccanctttgatctacttganactanccttccaag catacacaactaacctgccacgagcctttctggtctcaaactaacgagct cgccagagagagttcatgtatttcagtcagcgtccactcctctccagttt gtcctccaagaactattgcctttgatccttccatgacacatgtactgtgt ccccatgcaaacctcggaggtcgccctgggacgttcantattctccaggt gggtttctcttcngtcggatccnngangtananctgtgaacanantgaan acctgctactganccaccnaatatcntaattctccctccnggtangctca cnncaacntgatcnangc
Download
page-top