Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518275
Length 709 bp
Fasta Format > rwhcs10e07
cagcagattcatcgttaaaaaaggaacaccaaagtacaagttgacattac aagacctcccagtcaaactgggaatacatgctcatgtgaaacagctacaa ccaaagattaagagttccatgacaacagccgtgcttcaatctttaacaac agtccgcaggattttcacttcatggatgggcctatcatttttgtcggtct gaatacttccaaggcgcttaacaatttccattcctctggatactctccca aaaattgtgtgcttaccatccagtgattgacaaggtgcaagagtgatgaa gaactggctcccgtttgtattcggaccagcgtttgccattgatagaatcc cagccccggtgtgcttcagatctggccttatctcgtcctcaaattttgct ccgtagatggattcgccgcccctgcctgttccactaggatccccaccttg cacgatgaaatccttgatgatgcggtggaagacgacgttgtcgtagtatt tgcggcgcgcgagctcgacgaagttcctgcaggtcttgggcgcgtgcttg tggtacatctcgacggtgaaggcgcccatggaggtctccagggtgacctc cggagtccctccgtcgtcgccgccccacatcttgaggtggcgacaggcga gacaagagacggtggcggcggcgcgacaaagggaaagggagccagagggg gacggcggc
Download
page-top