Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518273
Length 805 bp
Fasta Format > rwhcs10e05
atagctccaacataaagcagtgcatacatgctaacaacagtgataaagtg acaaaatgacaagaggataacccatgaaagtctcaggcctctcagctaaa gtactcataacaccaacatttgataaatataaggtgatagctactagttc ctcattcctcttcctcgtcaccaccggcgtcaccgccaccacttgccttc ttctggttctttctcttcaccctgcctgcagggcctccaccgaatggact tgtcagtgagaagtcgatgtgcttctcagattcaaccctcaccatgaacg aggggacattgacgatctgcctgccaaccctgatgtggcgttgcctgatc aagacacgggcatggtggatggattttgccatgccagccttgaagacaag agtctgaaggcgccttgcaaggaagttctcagcagtcagggcaaggacgt aatcaagcttatcctggccctcagcaaggagaccatagcggttcatgcga cggagaagggccgcgccctcaaagatacggcggggatttttctcatccag tgtgagcaagtgtcttgcagcattacgaatcctgctcagtgcatactgaa ccctccagagctcacgcttgcacctcagtccatattcaccgaccagcttt agttctgcatcaagacgctccttctcataaggacgccttggtttcttgaa tgtcttaccatagttgcggtagaagttgacgtgcaccatggctggagctc tctcctctttcttccgctgccgccgccgccgccgccgctctgtggtcnag ttgat
Download
page-top