Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518271
Length 770 bp
Fasta Format > rwhcs10e02
ctggggcgatagattttgctactctcagtacaaagtactttactaattac tgtcaattgctcaaacagaacaacagccgctccacgcaaacagcgactaa caagaaagggcgacttaaaccttgaagccacggctgttcctcctaccacg agccttctcaaacttcctacccttggagcgcacatagggcttggtatggc tgtgcggcacaccaggtgctttgccgaagtgcctcaccgcctcacgggca ttcttgggtcccctcaacaggatagtgttctccccagttggagcacggag tgcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttg ccctcgctgtctctgtgaacctcagagcggtaaccttcattgctgggacc tcttggatccgcatgtcatctgtgattgtaccaacaaccacagcaatgtt cttctcctcctttcccttcatgaagttggagaggcggcgcatggagagcg gcgggcggttagtcttgctcatgaagagcctcttgaggatgacggcgttg aacttgctcttggtcctcctcaccaggaaacggtagagcttgacgaggag cttgaggtagacatcgtcggacttgggcgcgacgcgcttggtcctcttgt tcctcccgccggcgacgaggtcgatacccatggctgctcctgctgcggcg gcggtagggtttcctcgcggggtcgcgctgcggctgcggctgcttcttct tacctcgtcccggcacnagg
Download
page-top