Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518268
Length 853 bp
Fasta Format > rwhcs10d22
tttgtttccgagacatcaatgtcaatgcatcgaacatgcatacaattttt aatataatagccgtgcaacagcatcaaactcttagctgtacgagtcgtat ttgtcaggattaggcctgctatgtaaactaccacatccaatatttatacc agtaaacagaagtctcggaaggattttttttaattacagagatgaaacag gaaattaaattgacttcctaggcaatacctcaggcccactgccctttcat caaaccaatacatcaaattcagattttctggaggtgatttatgcaacaat tgagatggcatcatcatgtcgttggagtttcagctatgccacctgcccat acctttgaagatgaagaatgggcacatgcaggccttcttcagaaacagta gcatgcactaatttgaaccagacgtggtcacacaaggggtagaagtgttg ctagtactcgtagtagtattagagttactttcgttaaccctctcattgct tggttctgtagtgagacaaacttcagaagtagatgttgttgggctatagc ttggtctaccacttcctctagtttccaaacgctccatcatcctcgataca gatgcaattccattattaacttcgcgtctcacttcagaaccaagatcaga cacagatgagttacgtgaaaaaagcctctccttccaccctcgagtacttt ttgtaatagattctttgtacttcgaggagacagcatttaagcgcaacttt agagaatctgagaaagactgaacatctgatggcccagccctgtcattacc tactggagttgattgtccagaggaatgtctcctgttgaaaaacctaggac tgg
Download
page-top