Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518266
Length 743 bp
Fasta Format > rwhcs10d20
aattttattccaggaaggtcactaactaatgtaccgagtgagcaacgata cgcctgatgcagtatattccactgaaatcctagagtgtcttctccttatc cttccntgctaatatttgcctatacaagcaacaggagtaaaagactcatc gaaaaggtacttgggcacttttcttctctttcacagaccagcacagggtt gcttcttctccgaaagccagaaaaccggatgcaatgcctgaagtgcaggg ctttcaaaactgccgcaagatcttcatctatcagtttcttctggtagctt aacatttccaaaatgtatcagctccatctcgtctttccaaatgttgtgtc ggaattcaatcctaatgtgaggaacatttgtctggtggatgtcattgccg tcgggacctcttttatagtagtttctaccaatccagtgtgacttcagcct atgagagaaaccagactggnacacagaattcctggctatttcacacnagt cacaagagctaagcttccacagcgaagcagcaacactgtattcttcaacc aaaggttcttttgttaggtgaatttgtanagggtcgtcagttgagagaga aacattcaggcctcttaagaaaaatgttgggaacgggttcctgtggtagt caataaacaacgagttgttgctcaaaggagacattgcaagaccaatctga gcaaggataatacaagtactggaggacaggggacttctttaga
Download
page-top