Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518263
Length 854 bp
Fasta Format > rwhcs10d15
gtcatccatttgcacaatagtacggttacatgagctgccaattcagtttt tgtaccagtcaagaaacagaacagagaaagtaagaacaaagaagaaaagc aggagaaaggttctactgctgctgttccgctggatcgcctgggatagctc cttgttcccacgctccacgttgttcgttgcttccactgcctggtcgtata aatattgaatctgctgagcttgctgtagaacatgtgttgacataagatga ttaagtgctgacatctctatcatctttgtctccgtttcttggacagtatc aagaagattggtcaactccatctggagagctcgtgtttcatcgtccaaga gctgttcttgaactcttaagggcgcagttgatacctcccgatcttcaacc ttcgagacatcagatttcaatacaaggtttgacttggatggttcagtagg ttttatttctggcttcttcttgatcttctttcttggcatcaccctattaa tagcttcttgaaagcgcagggacctaaggcgatcaaattgtgcagttact gagtggagacgctcgctcaaaatcaaaaccacaccatgctggtgagctat caggtccaaccgggaagtctcatctcttgtgccaagccatatgttggctc ttctattcctctcatcttcaaggatcctgttctttaggatatctatctgt tccttgcatgcttttacaaaaataccaacttcatgctcaatgttgtccct ctcttgctccgtggtgcgatgcatgtccacatagtccctcctgtgcttca ctataaacttctcnagctccctgatgctctcaagcgtcttgattgctgca tttg
Download
page-top