Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518259
Length 650 bp
Fasta Format > rwhcs10d10
taactggatcataaacccacaaattcatcagtctcaataaacacaccgca aaaagaagattacatcgaatagatctccacgagagggggagaacattgta ttgagatccaaaaagagagaataagccatctagctactagctatggaccc gaaggtctgaagtaaactactcacacttcatcggaggggctatggtgttg atgtagaagccctccgtggtggatgccccctccggcagagctccggaaca tgccccaagatgggatctcgtggatacagaaggttgcggcagtggaatta ggtttttggctcctccttgatcgtttggggatacgtaggtatatatagga ggaaggagtacgtcggtggagcaacagggggcccacgaggtagggggcgc gcccangggggcnccctccncccttgtgaccncctctggcacttcttgna ntanantgcnnntctcctgnatcncnttcnnnnanannatcntgtttccn anngtttcnttccnnttnnactccncctnatnttccnnttcttcnnnnnn ctnnnntnnncnnnnnnnnnnnnttctnnnnnctctnntnnnnnnnanna nnnnncnncnnnnnnnnnnncnntcnnnnnnnnnnnntnnnnnnnnnnnt
Download
page-top