Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518258
Length 768 bp
Fasta Format > rwhcs10d09
tacatgagtgcacgaacgtgctagtcagtcgtggctaactaaatccctga atagggagatatgtttacaatgtacaacatcacggaacaacaacaatata tagggatgtttccaacagacatatttcttactgaactgccttgattttgt gccctttctgcatcagctgctggatcctgaaaatgttcacagggagggca ctagctgatggtatgttcagagaaggattgagtctgcacttgtttgcaga gatgacatgtcctgacaagatatacacaggcaaccatataatagtgttga tgatgcaagattgaacaatatattggcttgtttagcttctgttatcagaa tctgcatcttgtgtggtactgtttcatcacacatctaacacaactctgaa tctgtcaagcaaaaagtaacatcatcagacaaccaagggacatgggcaat ttcacacaacatgcaggatatttgcgattttagttgctcgacatgacaac aatggaggacctcgccgtggcacaatccggccaagagttcgcgccgccgc agccgacgaccaatagctcgcgccgccgtcgcgggagaccaaagatctcg cgccgcagccgccggagaccaagagctcgtgagcgccgcccgcgtacgac tgagcgcgctgaccctcgccatgtcacgctgccgctgatcttggggaaca tcctctctgccgccagcaatcggccgtcgccgtcgcgtcgcccgggagag aaaggggatgcctctgcc
Download
page-top