Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518254
Length 162 bp
Fasta Format > rwhcs10d04
gctccctgtaanggaacgaatccgacagaagctcgtcnccggaaagcttg tcctggtacacgagcatggtgccgcctcttgagatttctcccccgaaaaa agagaaaaccctaacgagctctgggggaggcagggntctctctctctntc tntctntntnnc
Download
page-top