Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518253
Length 656 bp
Fasta Format > rwhcs10d02
agccatctaaagatggtgctccttacaaagtttcaacacaacggtaacaa gcatacacgcagagaggtgggctatgctagattttctgtatactcagagc gcgcaagctggtaacgcctgctagcgctagcacacaactaaatatactgc accaccaatatatagctgctttgcatgtagactctgatatggagctggca gttgctcagaaaccatgaatcttgatgtgttccttcttcacaatgccggc ctggacaaggaagtttgagacgttcttcctctgatcaccctggagttgaa tgacctgtccaagttctgtgtcctggacaactgtaccattgcagcaaaac tctttcttgaggtctttgaggatcttgctgtagctgaactccttcttcag accctggacagtggtcaggctcttgcgaccattacgctgctggatgcgta catgaacgtagtcttttgatccggcagctgcaccagcgtccccagcattc gcctcggcaaaggggtcaaaggcagttgggatctgaacgtcaagatcaga catgaaatctcctgctgagactggcaaaagctgcaccaagaacctgggag gcggtcgaggaggaagagatcaaccaagatctttcccgggaggatttgga tcgcgg
Download
page-top