Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518252
Length 911 bp
Fasta Format > rwhcs10d01
gtacaacagatatccacggccttaaaatataggccggatcagatggaaag cctcaaaataatacagggagaacaagccgaaccattaagtggttaagtgt tgctttccgtaccatcgccgaatttggttggtctagttgaagtcaggctt ctcagggtaagtgcagccagactgctggatgataacgtttgctgcgtagc aaccggcctttacgcagtcctcgatgctcttcccttgcaccaactgagag aggaagcctccaacaaacgcatcaccagcgccattggtgtcaacaagctt ctccttgggcaataggatgacagggaatgttttcaccttcccatcctcgg ccacaactactggatcagcaccctgagtaatcacagcaatcctcttttgt tttccagaagccagaggcagttgtgagatcttcaaagcgatctcctcgac attctcagtctcccaccctcggactttagagaagatccttgcctcagttt catttccaaagatatagtccgcatacggaagaaccttctcttgggcatca cggaaaaactcgcagataaagggagcggagaggttcatcaagaaaacctt gttattggcagcagcatgctcagcaacaagctgaatagattcaggggaca ccgtaaggaaaaagccagcaatgtagatgtattttgctttctcaactagt gcccagttctctggcttctttagatgctcagatttgtagcagttcgcagc agataagtttgcaatcaatgacctttcgccaccaacaacacatacagcac atgtgcctgtaggagcagcctcatcctcatagtaatgagcagtaactcct gcagctttagcggcgctcttcatctcctcaccatacttgtcctttcccat gcaacccatgt
Download
page-top