Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518248
Length 811 bp
Fasta Format > rwhcs10c20
tgtcgccttcgatgtaaacatcaggatccattatactacgtctcttccaa gatcaccaccctaatccctgactactctcaatgtctatggttgtccagag cccggaggctaatcggtaacggttgctaattcttaagtttcatgagctta atatgcgcaccatgttggggctgcaaagtagagaccgggcatggcgcatg cgtataggacggtgagagctcgaacattaaatgctgcaggatgacgctca atcctatcttggcctcaagcaatgcaaagttctgcccgacacaaatccgt ggtccccagccaaacggaaagaacgccggcgagttcttggatgcaccggt gatgccctcagcaaacctctccggcttaaactcgtcgacatcttctcccc acacatctggatcatggtgaatgcacacaattggcagcgcaaatgtaacg ccggctggatatgtgacgcctcccagcttcgtctctttatacgcctcccg actaagtagcagaatcggtgggtacagcctaagaacctcatggagtatca tcgtcacgactttcagccggcttatgccctcagaatccggctggttcttc ccaaagacgcgcagaacctcctccctggcgcggtcctgccactcgggatg catgcttagcaggaccattgcccatgttagcagcaccgcggttgtctcca tgcccgcgaaatagaagagcttcagctcccctactatgtcgtcggtggtc atcgtcggcttggagcttccggcttcctggctttcttctatgttggactc catcatcacgc
Download
page-top