Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518247
Length 906 bp
Fasta Format > rwhcs10c19
gtctagatcatctgaaatggccatgaaattacaaagtgggaaggtggaac aacatttacacaagtatagcatgcaaaatcagcaacttatgtgtatagtc tacagcttcatcagggcaagtaaaaaaaaatcagtccggcctataaattg tacataaaaaactgcagttaaaccaatggacaattggaatggatgttgcc tacaatcgctgtgacaacaggctcaccagcaaggttgcacttgtagatca tcattttctgtgcaagggatatcttctcaactgaaatctccattccaaaa tcacctctggccatgaagtaattggtttcccacaaagtgtcatcaaagtt tacaatgccctcttggtttcaacctaccaattcaagaaagaataacaaca tagccgacatggtcacgggcaagcacgtatgtttataggcacagtagatt tagtcaacacagcagttgaacgaagctaagtaatctgaacaattttacaa gtaccaagaaataaaacttaccacaggagatgcaagaaataaaattaggc aaaacttgttcaacaaattatgctaaggcttttgtgaaccaagtgtattc attaaggaaagcacatagaagagaaccaattatgtattttttgactatat aacacataatagactataatgtttttttacaaacaggagtagatgtgaaa catgtcctcggagagacaaagagttcatgggttccagaatcaagtgtgta tattaacaaaaagttggacgttataacagtaagttgtcgagtgtgtatat taacaaaaagttggacgacataacagtaaggcaactcaatgaaaggaagg aacatcatctgtggttgcccctggtacttaactgacgtgcaaaaacattt catcag
Download
page-top