Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518246
Length 711 bp
Fasta Format > rwhcs10c18
agccatctaacgatggtgctccttacaaagtttcaacacaagggtaacaa gcatacacgcagagaggtgggctatgctagattttccgtatactcagagc gcgcaagctggtaacgcctgcttgcgctagcacacaactaaatatactgc accaccaatatatagctgctttgcatgtagactctgatatggagctggca gttgttcagaaaccatgaatcttgatgtgttccttcttcacaatgccggc ctggacaaggaagtttgagacgttcttcctctgatcaccctggagttgaa tgacctgtccaagttctgtgtcctggacaactgtaccattgcagcaaaac tctttcttgaggtctttgaggatcttgctgtagctgaactccttcttcag gccctggacagtggtcaggctcttgcgaccattacgctgctggatgcgta catgaacgtagtcttttgatccggcagctgcaccagcgtccccagcattc gcctcggcaaaggggtcaaaggcagttgggatctgaacgtcaagatcaga catgaaatctcctggtgagagtggcaaaagctacaccaagaacctgggag gcggtcgaggaggaagagatcaaccaagaactttcccgggaggatttgga tcgcggagaggcgctggcagtcagtccttggtgttcttcctcctctttgg gcggcacgagg
Download
page-top