Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518245
Length 810 bp
Fasta Format > rwhcs10c17
gaactgttccacgagtaccacaaacagcctagccgcgcttaatgtttggc cagccaaaagacaaaaccgatacagcgaccatccaacgtcgacactaaag ataaaaacaactaggcggtgcagggcatgaacatccgacgacaggcagac ttggcgcttagtcgacctcctccatcttgctctcaccagcgtcgtcctcc aggggcggcatgtcggtgtcgttctcaggcgcctcatcgtcctcgtcaat gctcaggccaagcttgagcatacggtggatcctggtgccgaaggtgttgg ggtcctccaggctgaagccggaggtgagcagggaggtctcgaagagcagc atcaccaggtccttgactgacttgtcgttcttgtcggcgtcggcgcgctt gcggagctcgtccatgatggcgttctcagggttgatctccatggtcttct tgcttgacatgtagccagccatgctcgagtccctcaaggcctgggccttc atgatcctctccatgttggcggtccacccatactcgccagtcaccagaca gcaaggggagtccacaacacggtcagagacgatgaccttctccaccttgt cgcccagcacctccttgatgaccttgcacagcccctcgaacttctccttg agctcctcctgcttcttcttctcgtcctcgctctcatcnagcttcanacc ctccttggtggcanagacaagcttcttgccctcaaactccttgagctgac caatggcatactcatcaatggcgtcaaccatgtanatgacctcatanccc ttcttcttca
Download
page-top