Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518240
Length 869 bp
Fasta Format > rwhcs10c08
gggttttttttcttttctattgatgtcaaaatctgggatacaactaatga aacaaaaataacatatgttttattgagaaaacaacgacacttgttacaac aaaggctatatgagggacaggttacaaatatacatccagctcaagccgcc agtttggccaaaatcaccatatctaagatcttgacctcataggtgtcgtc gagcttcacaatgccatcagaaccgtctattcctataagttttccaacaa atccgcggaaggtaccattcatgatcttgatcctgtcactcttctttggt ctgatgacctcgagctcagtcggaaggaccgtcacaatgtctccgttgcc tgacgacccaagtgccacacggcaagttccatccccaagcacttccctga ccacaccaggtccttcatcacctgccgccaagacattaactaacacatct ggcaatgcccagttaacttcgccctcgccacctattacaggagacattat atccattccagcattgcctggagtcattggttgaccaccaggtgtaccag gaaggtacgcagcagaatttggtgtcattggctggccaacaggtgtggaa ggcacatatgggcttggagcattcgcatagttgccctctctaggagttgg gacgtcattataactaactcctggagtatttgcccaccctgatccaggtg ttggggcttcatatggccgagctggtggtgttcctggctggtaagctgga ctgcttccccaagtatcaggatttccatcttcccaattatctcttggagg actcataggagcccaggccctactacgcatcggggtccgcattccatcat ggtatcggtgttgctccag
Download
page-top