Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518239
Length 556 bp
Fasta Format > rwhcs10c07
accacaccaatttcacgattaccattacaaagcaaatcccacaattatca gaaagttttcaagacactcaacatctgacagttactgacaccaacattgg agagtcgactgacaaccatagataagagcaaaaatactgaagacagcata gattttagcatacagtgcgattagcacttgacctctttcagcccatgtgc aaagtacaggaaagttggatcagcagctccctccttgtagtaggcgaaca ccacgccgccatcatcatgcatgctctcgccaacaaagaactgaaggtcc ttgagcttgctaagaagatactttgtggcggactcaacattcttcttgaa agcatctaggtcatccccttcaagcttggcagagaggttcttgatgtagc gcttcatgtgagagataaactgcttcttgtcaaaagcaggttgctcctga agacggaaggtgtcaacaatgtcaaccaccttcacggcctggtcatcaac accctcatcatcaccaccaccctcagcagagggattggctccaatgtcca catcaa
Download
page-top