Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518238
Length 880 bp
Fasta Format > rwhcs10c06
ctggaacaaagtttatacagaacctcgtcaaaacagctttcagttttttc acacacatacaaccaaataagatcaggaaagccaagactatccgtggatc caaatgatatcactgaaccaaaacaaaactagcagaaaggagtaagtttt agtcgctatcatcttcgtcttctcgcgtttcaagctgggagacaaccttt tctatgaacttcctgcgaacgccttccatgacattgttaccaccttgtcc atcattcagtactgggtctgagtcgcaaagcgccaatgcaacagattcag gtgtgcatttctttccaccgaacttctgtagaccaacataagtccctttg acagcactgttgttgtacaccagtattgtaggaacattcctatctgggta gttgggaatacagtccgtggaaataattttaacaaacttggtttctgcat attttgtcgccagttcctccaggcaagtctcaagcagcccacattctggt atcgcatccttatagaggaagaccacaacccagacatccggtggagcctg cgaaacctcacgcacaaaatcagagcctgtgatgggctgtactgtgccga atctggcagtttttgctgcctccttgagctctgcaagcctcatcctccag atttctatggaaatcacacgattaccccccatcctgtactgctcgaggaa gcggtcgtcgtcgaggtcgtcctcgagctcctcgagctcgtcggggtcgc gcgcgtcgagccactccttggacctgggctgctcgtcggcgtcggccctg gggggcgaagggcggcggcttgaaaggcggcggcttctcgggcaggttgc cgagcttgcgctggatgtcgtcccnctgcg
Download
page-top