Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518237
Length 712 bp
Fasta Format > rwhcs10c04
aggggggctagcatggttctgagcacttaaattggaaccatgcagaagat ggagcgagattgggagcaggcgaaggagcaccaggacctgccttccaatt cctagcatttttacttactagtatgtcaaaggacatcccgtctggcggat gcagcaatgcttggaatgctatgcccacaaagagcgtggccaccgtcatg agccaaccacgcatcttgtccacaaactctttatcaccatcttctattgc atcggccagtgccaaatcacaaccggcggcagcttctctagctttcgaag ctgctgcatgggcaagcggcacagcaaggccagcttcggcaagggccaca gcgaggtcggcggcggctttgccaggccggttggcaccagctgctgctgg tgcaagcggcacagcaaggacagctcgggtgcttccgcaaggggcagagc gaggccggccgcaacatcggcaacatcgtcgccagctgcggctgcatcgg cacgcgctgcaacacaacggtcagcagctcctcgagcttttctcgccatc gccatagcttcgtcaccacctgctgcctcacagcgggaagcgatctttcg agctgtcgaagctgctaacacagcacggcgacttgccgcggcacagcgaa ccgcgctttctcgaacagccaacgctgctgcgactgcatctttacgtgct tccggcacgagg
Download
page-top