Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518230
Length 866 bp
Fasta Format > rwhcs10b17
tttcttttccaacagaaagtttctttttcaagaaggcattctacacaggt acattagtccaataccactctatgtagatgatatgcggccatttttgctc acagttatctgccatgttccactgactacactgggaacatacaagccata actcaagtttatagcctgaaagataaacttgacaggctgtggcttggatc aggtcgcggcaagaatggccgccagattggtcttcgagtgcagatgaata cgacaccttttaaccacgctttactggcctctgaacataagatttgttcg ggtcttcagtcttgagccttggaggtttgagctctcctttccgtgccttc tttcctgtcttcatgaaatccctccagctagagactcgctggtctctcgt ctcctcccacttctcttcatgctctctcttcctcttccacatttcttttg tttcctcctcgtccttcttcagtcttccttcttcctctgatatcctcatc tgcattttcctccgacgccattctttgtctgtcaaaatctcacgaacttt aattattagctgcttctgaaattcgtccgatctttcaaactgctcttcat actttccctcatctacttgggattttatcttagatgcactgtctttcctc aactcttttttcctttttgccctcagttcttcttttgcagaagtgacttg atcaagaatgtaccctctttcctgtggatcaagtaggagctgctgtgctt ttgccagggctccaaaagcttcttgtgcttgtggatgcttgcacttgtca ggatggaccaacagtgacaacttcctatattgcttcttcacctcatccac agaaagaatcaaaaga
Download
page-top