Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518229
Length 864 bp
Fasta Format > rwhcs10b16
gttttttgcaacttatctctctgtccaataaacatactaagctgaataaa cgaacatcaccccaataaacaaacgcacaagtgactagtctgtatgatta catctaagtattcgcctccactgtctgtatgcaagttctttggtaatact agtagtaataaacattgacgacgatcagctctccatctcaacgacaatct taccagtggcatggccatcgatactgctctgccacgccttgcctgcatcg ctcaacgggaacttggagtcgatcaccgtcttcagcttgccttccttgag caacccaaccaagaactccaggtccgccttgttgggcgacaggagcaggg gcaccaggcgcttcttggaaaatgtcaccctgtgcagcgcagatgtgagg atggccgacaagttgggggtgatatcgatcactctcccggcatcactgag caatggctggaaaaacgaccagctgacaccgacggtgcagtgaaccacgc cgtcgtactttctgccggaggggctctgcaggctcgccccctctggggtc ctgtagtccatcacctcgtctgcgcccaagctcttcacaagatccatgtt gcgtgcgccgcaggtggcggtaacatgaaggttcgctagctttgcaagct gcaccgcgtacaggcctacgccaccagaggcagcggtgaccaacacgttt aatggcttgccggtgccgtcaaacttggcaccaatggacctcantgcctg gagcgcantgcctgcancaatgggaagcccagcaccctcanctgcanaaa cctcanctggccttttgacggtcaggtttgcggatgctacancgtactct gccantccacctcc
Download
page-top