Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518223
Length 660 bp
Fasta Format > rwhcs10b08
cgctcattgtggcagacgcagcaaaccacctantagctaatagtttattc ggagtagcaatagcctggccagtctgnttcacagttaaccnaacgacaaa cttagtcagaacanagtccncagacggaacngcgacagccaatcactcgc acagcaccgcgccctcctccagggaatcctcctccgcccgccatgcgagg aggttggcgagcttgccttccttgaccanagggtggctctgcacactctc ggcctcnaagcagtggaaganggacctgggcgacccggnagagacagcaa cctcttcgttcgcggcaaagctctggtagatgaggacgcccccgcagggg agctcctgctccacaacgttgttgcagtcgtatgcctcagcttcgagctt cttgccccaggtggcggcgtggccacggccaccgaagatggtgaccgcca cagagaantctgaagggccaaagcaccggaggaccctcttgacgatgtcg ccgtaggccagggcggaggcgtccatgcccatgacctcgtagctcgcgta gctgaagccgtcctcgggggtcacatggatggtggagacggcanatccgt tgatggcgttcatggagtatccgcanggctcgaagtcgaagtcacngacc tccatctcag
Download
page-top