Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518222
Length 431 bp
Fasta Format > rwhcs10b06
aaatgcgcccctcccanaagtcggggtntgttgcncgtattagctctana attactacggttatccgagtagcacgtaccatcaaacaaactataactga tttaatgagccattcgcagtttcacagttcaaattggttcatacttgcac atgcatggcttaatctttgagacaagcatatgactactggcaggatcaac caggnagcacgtccttgntgactaccagcacggccatcgttctgcgcttc nactttcgtggaaactcagaggcancagccgggccggttgtcgctcttga ncngcacagctcatcgtccttgaggatcggcgcagagagttgcgtatcct accacntaactgtggagaggtagcaggcaagtcctgttccggttgttctc agttcgganagctttgggtcgggtcgaggca
Download
page-top