Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518221
Length 921 bp
Fasta Format > rwhcs10b05
acgtgtctcgttgctcaattatacaacattaataacaacaaaaggggaac agagcccatccattatcagcatggaagtataggtagattactgggctaga aataactctcagactcttaagggtaaattacatgtactccaagctggact aagaatagcttctaaagaaccgtgacgacagtagcttagttagctagaca tcatgatctggtcacacgcctgaagggcctggtttgcatagtatcgtaca tccacatcagggtcctcgctcagctcgacgaggcatggcttcacagtaga ttgatcaaggattggtacaagcgactgcagaactttcgcaacattgaact tgatgttcggcactctgtccttcgaggaattaatgacgacagggagcagc ttttggcatgttatttctgcacccatgacaggggctagcaatgagatagc ttgcaggatggtcatgcgatacagataatgtgggttgtttatcttctcca acacctgaggaattatgtgttgcatagcccactctggaccgaactcctcc gccaggcgcttcaagttgtttgcggcagcttctctgatcgagaaaacctt atcttccaaccattgcatgcaaagtgcccccagcttgtcatcaaaaaacc caacacctaactgactagccagcagagggatgtactcaattattgcaagc cgaaccctccagtgcctatcctccgcaagttctacaatagccggcaatag agattgcgacagcaagtcaattccaatgacctgattaacttgatcaagct tgctgattatgttcagtcgaacatcaggaaattcatccttcagcaaagaa agaaaaataggaagaagttgttcaatggtagcatccttccccaagacagg ggnccattcccatgatgactg
Download
page-top