Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518219
Length 468 bp
Fasta Format > rwhcs10a21
gtagatgggcacacaaccaaagcagccgggacagcagcacaccgagttca gaccccaagcttaggtcaacaatcagtcattgcggaacatgataatagta ggtggattatgacagcttctctctctctctctcttttatctctctctctg tctgattgggcagatatcactgcttgaggtgagggaagcactggacgagc tcgctcttcggatgctttgcctcggcatgctccttgcactttgcttcaga ggtggtgcagatgaaagtctgcatgcatatcttgcactggatgttcatgg ccttcttgttggcctcgagctggctccccttgccgcccttcagcttctcg aggttcctctccctcgccatcttggacttctgcgcgttgccgccgcccat ggctgttgattcctcgacgagacgagacgagacgatgctttttctgcttc ggcggaaatcctcgtccg
Download
page-top