Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518212
Length 817 bp
Fasta Format > rwhcs10a14
acttctccccagaagtacgctcattgtggcagacgcagcaaaccacctag agctaatagtttattcggagtagcaatagcctggccagctgcttcacagt aaccaaacgacaaacttagtcagaacaaagtccacagacggaacagcgac agccaatcactcgcacagcaccgcgccctcctccagggaatcctcctccg cccgccatgcgaggaggttggcgagcttgccttccttgaccagagggtgg ctctgcacactctcggcctcgaagcagtggaagacggacctgggcgaccc ggcagagacagcaacctcttcgttcgcggcaaagctctggtagatgagga cgcccccgcaggggagctcctgctccacaacgttgttgcagtcgtatgcc tcagcttcgagcttcttgccccaggtggcggcgtggccacggccaccgaa gatggtgaccgccacagagaactctgaagggccaaagcaccggaggaccc tcttgacgatgtcgccgtaggccagggcggaggcgtccatgcccatgacc tcgtagctcgcgtagctgaagccgtcctcgggggtcacatggatggtgga gacggcagatccgttgatggcgttcatggagtanccgcagggctcgaagt cgaagtcacagacctccatctcagggataatgtcanagattccanagagc ttggtcatctccttggcacaggaaacgtggccatcancttgagtcttgaa naanacagaggccttcttcttgtccancccantcatgcacatctccangg tgaccatgggctgctca
Download
page-top