Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518209
Length 918 bp
Fasta Format > rwhcs10a06
ctgtcctgtaaatcatcaggcaaaaggggagctacaagcctcattcatac acacttggaaaaccagcgaaaaggagcatgcatcgcgatgtgcggctgtt ctgggtggagacgagagtttctaaagagcggaaggtttcatttattcaaa acatccagaggagcagctgcccttcgaatgtggatttacgccaggcatga gtaggccaacgccttctcctctgacagctcctgggcggtcgcatccatct tcttcctcgagaactcatcgatcgggagcccttgaacaattgtccattca ccaccactgcacgttactgggaaggagtagataagaccagcaggcacacc gtatgaaccatcagagtacacacccatggaaacaaatgttccctcagcgg ttcccagaacccagtcacggatgtgatcacaagctgagctggcagcagag agagcactggagagcttcctcgctttgatgattgcagcaccacgctgctg gacagtggcaatgaactccccatttagccattcatcatcttgaacaagtt cacgaacaggcttctctccactgggagtcttcacagtggcatggttaaca tcaggatactgactggacgagtgattaccccagataatagcattcttaac gtcagaaacttggacaccaagtctctcagaaatctgaccgagtgccctgt tgtggtctaggcgggtcaaacaactgatgttcttctcagggatagatgga gcaaactccttcaggatgagagcattggtgtttgctgggttggcaacaac caaaaccttgcaattgggggctgcatgagcttcaagagcagatgcttgag ctttgtanattgaaacatttttcgtcataacatccttcctttccattncc ttccttcctggggaatcc
Download
page-top