Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518208
Length 586 bp
Fasta Format > rwhcs10a04
aacatccacattacatctagcagcaaccacgagttcgcaaatcaacaaac atcaggcaaaacttaaaaacgatggttccaggaacataggtctatatcct tgcagataactggctatagcaaaacgactcaacacctcagaatcaggcct tggcagcagcctgggcagcggcatcccgcttcctctgctcctcaatgatg gtgagcttgatacccttgcccttggggaggctcacccacggcttggtgcc cttgccgatggtgaacacgttgcccagacgggtggcgaactggtggccct gggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctg ttcttgatcacaccaacacgcccagtgttgcgcccaccagtcaccatgac cacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcca ggtcaagcttgatggtgtcattggccttgatgagtgggtctgggtagcgg atggtgcggccatcataggtgttgaggtatgggatgcccttctggccaaa ctggacagacctgaccttgcagagcttgaacttagc
Download
page-top