Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518207
Length 239 bp
Fasta Format > rwhcs10a03
gtatacttaggangagcnaacaatcatgaaagtacaacaccgaaccaaaa tgctggaagtccaaactccanagcacgtacgtccggtacgggactgctta naacactctgggcttggcgacaatggtggantgcttgaggatgtggaggc tgaactggccacccttctcaaatcgtgtcaagcttgtcctggncgggcgg nggcgtgagcacnaanttctggacgagggngannatggt
Download
page-top