Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ629552
Length 769 bp
Fasta Format > whcs19p09
tgaagttctctgtgtcccctgttgtgcgtgttgccgttcagtgcaaggtg gcatctgatcttcctaagcttgttgagggtttgaagcggctggcgaagtc tgaccctatggttctctgtagcattgaagagtctggtgagcatatcattg ctggagctggagagcttcaccttgaaatctgtttgaaggatctgcaggag gacttcatgggtggtgctgaaattattgtttcccctcccgtcgtctcctt ccgtgagactgttcttgagaagtcctgtcgcactgtcatgagcaagtccc ccaacaagcataaccgtctttacatggaagctcgcccattggaggaggga ttggctgaggctattgatgatggccgcattggcccacgtgatgatcctaa ggtgcgctctaagatcctatctgaggagtttggttgggacaaggatctcg ccaagaagatttggtgctttggacctgagacgactgggcccaacatggtt gtcgacatgtgtaagggagtgcagtatctgaatgaaatcaaggactctgt tgtggctgggttccagtgggcatcgaaggaaggtgcattggctgaggaga acatgcgtggcatctgctttgaggtctgtgatgttgttctgcacactgat gctattcacaggggtggtggtcaggtcatcccaacagcccggagggtcat ttatgcttctcagctcactgctaagccaaggctactggagcctgtgtacc tggttgagatccaggcccc
Download
page-top