Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ629530
Length 699 bp
Fasta Format > whcs19n24
cgtcttcgcatcgcctcgcgcccgcaccccaggaaggtaagttcaagagg cttttctgagaagctcaaatggctcccaaagttgctgttgccaagaaggg cgatgccaaggcccaggccgccaaggttgccaaggctgtgaagtctgggt caatcaagaagacggcaaagaagatccgcacttctgtgacatttcaccgc cccaagaccctgtccaaggccagggaccccaagtaccccaggatcagcac ccctggaaggaacaaattagaccagtaccagatcctcaagtacccgctta ccactgagtctgcgatgaagaagattgaagacaacaacacccttgtcttc attgtcgacctcaaggccgacaagaagaaaataaaggctgctgtcaagaa aatgtatgacattcaggccaagaaggttaacaccctcatcaggcctgatg gcaagaagaaggcgtacgtgaagctgacaccagactacgatgctcttgac gtggccaacaagatcggcatcatataagccagagggagggtcctgcagta ggcgcttgtgtcgtggtttcttatgttattggaattttgtagttgttact tagcaaagggccttagtggctccattgcctaccatatcgctgcacacttt catgaatttgatgcaatcgaagtgacttgtgttgatgctaaaaaaaaaa
Download
page-top