Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ629436
Length 718 bp
Fasta Format > whcs19h23
cgcctctccgcgatccaaatcctcccgggaaagttcttggttgatctctt cctcctcgaccgcctcccaggttcttggtgtagcttttgccactctcacc aggagatttcatgtctgatcttgacgttcagatcccaactgcctttgacc cctttgccgaggcgaatgctggggacgctggtgcagctgccggatcaaaa gactacgttcatgtacgcatccagcagcgtaatggtcgcaagagcctgac cactgtccanggcctgaagaaggagttcagctacagcaagatcctcaaag acctcaagaaagagttttgctgcaatggtacagttgtccaggacacagaa cttggacaggtcattcaactccagggtgatcagaggaagaacgtctcaaa cttccttgtccaggccggcattgtgaagaaggaacacatcaagattcatg gtttctgaacaactgccagctccatatcagagtctacatgcaaagcagct atatattggtggtgcagtatatttagttgtgtgctagcgcaagcaggcgt taccagcttgcgcgctctgagtatacggaaaatctagcatagcccacctc tctgcgtgtatgcttgttacccttgtgttgaaactttgtaaggagcacca tcgttagatggcttgttaccctctcccatcaaggttgaataataatatat gctttcttaaaaaaaaaa
Download
page-top