Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ628915
Length 645 bp
Fasta Format > whcs17f15
gatgctattcggagctctcttcaagaacacttctctaaatgtggagaaat cacacgtgtctcagttccgatggattatgagaatggtgcaagcaaaggga tagcttacatggattttactgatgagagttccttttcgaaagcacttgag cttagtggatctgacctaggtggctgcaacttgtatgttgctgaagctaa gcctaagggtcaatttggtggcgttggtggtcgatctggtggcagagatg gtggccgctctggtggtggcaggtttggccggtctggtggccgtgatggc ggcggcaggtttggccggtctggtggccgtgatggtggcggcaggtttgg ccggtctggtggccgtgatggcggcagaggaggcggccgaggctttcaga gcagacagagtgctggcacagctagcgcagggaagaagaccacatttggt gacgattagaaactttttgagccacaaaatggtctgatgcaactgccgcg tgtctagacgactgtatccccgtgtttcccattatcctagtggacctagt atcatttgtctgtagtattttcttgccgctatatgttgtaatgccagaat tctactatatatgttacacctantgtttttataataaaaaaaaaa
Download
page-top