Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ628640
Length 860 bp
Fasta Format > whcs16e16
cgctccctacactccctccttgcctctacgccgccagcggtccatgggca agtcaagcaagaagtccgcggcccctactgtcgtggcgccggcggccgtc cttaccaaggggaaggccgggaagaagcgcgaagccgatgacgagatcaa gaaggctgtaagcgcaaagaaacagaaggctgcgccggcaaaggcggtgc ccgggcccaaagaggccgccaagaaggccaagaagcagccgccgcccaag aaggttgagagcagcagctctgaggagcagtcatccgagtccgaggagga ggaggttcctaagaagactgcaaagcctgtcaaacacgagtcttcagatg atagcagcgacgattcctcctctgacgaggaacctgcaaagaagccttct gctaaacctgtgaccccagctgccagcaacggctcaaagaaaggcaagcc tgagagcagctcttctagttctgaggatgagtccgatgatgacgagaaac ctgctgctctggtaaagaaaacaccagtcatcgaatctgacagctccgaa agtgactcagatgatagctcagatgaggatgttcctgccaagactcctgc tgctgctgccaagaaggtagattcttcagacagttctgagtcggagagtg aatctgaggatgaggagaagtcaaagaaagccgcacaggccaccaagata gctcctgcagctgctaaaagaaaggaggagcccagtgattcctcagacag tgatgagagtgatgaagagcctccccagaaaaagctgaaggatgctgcga aggttactcctaagtctgccaaaaaggacagcaccagtgatgatgacagt tctgatgaaa
Download
page-top