Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ628622
Length 764 bp
Fasta Format > whcs16d15
aagggaggaggagagcggcggcgaagatggtgtcgctgaagctgcagaag cgcctggcctcgagcgtcctcaagtgcggcaagggcaaggtctggctcga ccccaatgaggtcaacgagatctccatggccaactcccggcagaacatcc ggaagctggtaaaggatggtttcatcatcaggaagcctcagaagatccac tccaggtctcgtgcaaggagggcacatgaggccaagcagaagggccgtca ctctggatatggtaagcgtaggggtaccagggaggctaggctccccacca agatcctgtggatgcggaggatgcgcgtcctgaggcgccttctgcgcaag taccgtgaggccaagaagatcgacaagcacatgtaccatgacatgtacct gaaggtcaagggtaacatgttcaagaacaagagggtcctcatggagagta tccacaagtccaaggctgagaaggcaagagagaagaccctctctgatcag tttgaggccaagcgcgccaagagcaaggcaagcagggagaggaagcatgc caggagggaggagagattggctcagggccccagagatcatgcaccagcac cagcggctgcagctccagctccagcagcagcggcaccaaagaaggccaag gccaagaagtgaaggtctgacatgaagctttagctttctggtatcatgaa gggttagcctgattttggagcatctgaagttcanaactgttttctgtgca atatctgtgtgccg
Download
page-top