Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ288109
Length 613 bp
Fasta Format > whsl12n06
gcgactttgaccgcctcctcgtctccgctcccacgcccgcgggagagagg cgaccggcggcggcgcgcgaggaggggcctacccacccatcccaccaccc cgccggcgaagatgttcggccgcgcccccaagaagagcgacaacaccaag tactacgaggtgctcggggtgcccaagaacgccgcccaggacgacctcaa gaaggcctaccgcaaggccgccatcaagaaccaccccgacaagggcggag accccgagaagttcaaggagctggcacaagcctatgaggttttgagtgac cctgagaagcgtgagatctatgatcagtatggcgaagatgctctcaagga aggaatgggtggaggaggaggtggtggagttgatccatttgacatcttct catcatttttcgggccctcttttggaggtggtggtggcggcagcagcagg ggcagaaggcaaaggaggggagaggatgttgtccatccacttaaagcttc tctagaagatctttacaatggtacctcgaagaagctctctctttcccgta gtgtcctctgctccaagtgcaagggcaagggatccaagtctggtgcttcc atgaggtgcccag
Download
page-top