Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ628463
Length 779 bp
Fasta Format > whcs15j10
cccagaacctggctgatagatcgccgcaccaattcgttgaagcttgctga cttcggattggccagggcgttcggcattcctgtccggacatttactcacg aggtggtaacattatggtacagagcaccagaaattcttctgggtgtgagg cagtattctacccctgttgatgtgtggtcggttggttgcatttttgccga aatggtgaatcagaaacctctatttcctggtgattctgagattgatgaac tcttcaagattttcagaattatgggcactcctaatgaagaaacctggcca ggtgtttcttcgttacctgactacaaatcagctttccccaagtggccatc cgtggatctcgcaactgtggttccaacacttgaacctttgggacttgatc ttctctctaaaatgctctgcttagatccaaccaggagaatcaatgcccga actgccctcgagcacgagtacttcaaggatctggacgtgtcctcgtagat catgtcccctgctcctctgtaaattaagattgcgtcggttgctcgacagc ttcctgaatcctcccggactgtgtgctcctttctctcctattctttctga ctctggctgtgtagagagaaatgagaacggaaacgcctcctgatccaccc ttccgtgtagaccaagcaaattgaaaagatcctgatgctctgggagctct gcattgtgatttcacccgtatttatatggacatcgacgccggcaccagac ttgttcatgtacgatgaattttggagtag
Download
page-top