Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ628461
Length 855 bp
Fasta Format > whcs15j06
ttgcctctacgccgccagcggtccatgggcaagtcaagcaagaagtccgc ggcccctactgtcgtggcgccggcggccgtccttaccaaggggaaggccg ggaagaagcgcgaagccgatgacgagatcaagaaggctgtaagcgcaaag aaacagaaggctgcgccggcaaaggcggtgcccgggcccaaagaggccgc caagaaggccaagaagcagccgccgcccaagaaggttgagagcagcagct ctgaggagcagtcatccgagtccgaggaggaggaggttcctaagaagact gcaaagcctgtcaaacacgagtcttcagatgatagcagcgacgattcctc ctctgacgaggaacctgcaaagaagccttctgctaaacctgtgaccccag ctgccagcaacggctcaaagaaaggcaagcctgagagcagctcttctagt tctgaggatgagtccgatgatgacgagaaacctgctgctctggtaaagaa aacaccagtcatcgaatctgacagctccgaaagtgactcagatgatagct cagatgaggatgttcctgccaagactcctgctgctgctgccaagaaggta gattcttcagacagttctgagtcggagagtgaatctgaggatgaggagaa gtcaaagaaagccgcacaggccaccaagatagctcctgcagctgctaaaa gaaaggaggagcccagtgattcctcanacagtgatgagagtgatgaagag cctccccanaaaaagctgaaggatgctgcgaaggttactcctaagtctgc cnaaaaaggacagcaccantgatgatgacagttctgatgaaagctctgat gatga
Download
page-top