Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ288090
Length 550 bp
Fasta Format > whsl12l19
accgcaagctagggtttccgcctcgacgcggagggctcgccatggatgcc gccgcccgcaagagatcccggccggagtccgccaacggaggcgccgcagg cgggaagcgctcgagagaatcggagtcacaacaaactggtctatcaagca aatcgaagccttgcaccaagtttttcagcactgttgggtgcccctttggt gagggatgtcactttgcgcactttgtccctggtggataccaggcagtatc aaaatcacacagcctaggccatgctgctgtgtctgcaccgtcaagagctc ctgcggatcatgctgcttctggtgtcaaaacacgcatgtgcaccaagtac aacactgcagaaggctgcaagtttggtgacaagtgccatttcgcccatgg cgagagggagcttggcagggcaccatcctcctacatgtcccaggaaagtt cctatgctcctcctatgggtggtcgatatggaggtcggcacgaaccacct ccgccagcttcgatgggccctccagctggaaactttggcgcctcgtccac
Download
page-top