Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ628332
Length 806 bp
Fasta Format > whcs15b13
ttttgacccagctcaggccgtttttctcactgattcccaaggccaagact gcaaaaattgtccgtggaatcattgatgctgtttccaagattcctggaac atctgatctccagatctcgctgtgcaaagagatggtggaatggacccgtg cagagaagcgtacgttccttaggcagcgtgtggaagcaaggttagcggca cttctgctagagaatcaggagtacactgaagccctgactctccttactgg tcttattaaggaagtcagaagacttgatgacaagttgctccttgtggaca tagacctgttggagagcaagctccacttctctctgagaaacctgccaaag gccaaagcttcgttgactgctgcaaggacagcggcgaatgccatctatgt tccaccagctcagcagggcactattgatctgcagagtggaatccttcacg cagaagaaaaggattacaaaactgcttacagctacttctttgaagcattt gaagctttcaatgcactggatgacccaagagctatcttcagcttgaagta catgctcttgtgcaagataatggttaaccaagctgatgatgttgctggaa taatctcatctaaggctagcctaaagtatgttggtccggatgttgatgct atgaaagctgtagctgatgcctactctaaaagatctctcaagtactttga aactgccctccgtgatttcaaagcccagcttgaggaggaccctattgttc acaggcatctttcctctttgtatgataccctcctggagcanaatctgtgc aggttg
Download
page-top