Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ628320
Length 663 bp
Fasta Format > whcs15a20
ttgacacccttgacctaagcatcccaaggaagctccttctgtgggtatat acattagttcacggtcgatattgcaacatatccgctgtcgtaaagtactg cgatgagatgaaggcaagaaataaaagaggaaccctaacggcggcagctt catcacaagtcacgcctccagcaccgcacagctctgtttcttctctggtc acctccaaagaaaagagtgcgcataccgtgtccagtgaagttcaagaagc aaatgcctctgctccagtagcagccactgttcctctccaccaagaagcag agggcagcgcatcgctgattgccaccgaggcacagaaacccagcaccgcg gcatctcaactgtcgcgcagcagctcatctaggacaatggaaagtgctcc ggatggcggtcaaggcaatgccggtgcagcttgattgtacatcatgcttc tgtacacccatgtgagctccgcggatggtcatgagttctgattagattga aggcttcttcccttccagcagaaatatgatgtacttactgcagttgtagc aggactaggtctgatgcctttcctggtgtataaaactaacattgtattag aagctaatgtaacactaaggacatgcaagttcggtgagtgtttggttgta gccaaaaaaaaaa
Download
page-top