Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ628195
Length 856 bp
Fasta Format > whcs14j05
tttccttcccctcctccccctcctctccccgcctgctccgtccatccccc ctatctcctccccgcctccttccagctcttgtactactcggagcgcctcc acccccgaccccgaccgcccaaccacctgcctcttgcttctcccgctgtc cgggccaagaatccgagatcctccccggcgccgccgcctgtttcttcatg gncgcatagatggcaggatcaacttcattttgagcttgtcccacaaggtt gcaatcaccagtatgtcagctaaggcttcagaacgtacgtatagatgctc agatgattcacaaatggcgnactacaacaactcggtgcctttagcagaaa atggacggttctatatgatgcaaaatcatctggatgttcactacacatct tcaggtgatgggtcacagaaaattagttccaatcctcaagtatttgaagc acagtactgcacactcgaatcatcatcggcaaatggtgtttatcctacac agagctccacatcttctcatagcatctcccctataagtgggagccccctg tctcagaatgatagccactcataccacacatatgattcacccccaactgc ttcatgtgttaccgagataccggatttccagagtaaactaaaggagctag aaaatgcaattcttggacctgaattggacatagcctttgacagccccgag agcttattgcaagccaaccatcctttgaaacaagataactggagacagct tctggggaattaacacaggagacttgaagcaggtgatcatagcatgcggt aaggctgttgctgcgaatgatatgtatgcgacagaaactattgatatctg agctag
Download
page-top